Test de paternité

Un Test de paternité est une pratique scientifique basée sur l'analyse de l'ADN de deux personnes faite dans l'objectif d'établir un lien de parenté génétique et, partant de là, peut-être juridique.



Catégories :

Génétique - Droit de la famille - Famille

Recherche sur Google Images :


Source image : blog.annuaire-du-net.eu
Cette image est un résultat de recherche de Google Image. Elle est peut-être réduite par rapport à l'originale et/ou protégée par des droits d'auteur.

Page(s) en rapport avec ce sujet :

  • ... Labo de tests de paternité - Bonjour Si envisageable quels sont les laboratoires... une région restreinte du bras court de chacun de nos deux chromosomes 6..... notre test de paternité est jusqu'à 250 000 fois plus fiable que les ... services des tests de filiation, dont les fameux tests de paternité.... (source : experts-univers)
  • Test de paternite est un site spécialisé dans le test de paternité par adn, vous trouverez sur ... Vous avez des doutes sur votre paternité, filiation ?... dans une région restreinte du bras court de chacun de nos deux chromosomes 6.... (source : miwim)

Un Test de paternité est une pratique scientifique basée sur l'analyse de l'ADN de deux personnes faite dans l'objectif d'établir un lien de parenté génétique et , partant de là, peut-être juridique.

Si, en règle générale, l'identité de la mère d'un enfant ne pose pas de problèmes, celle du père peut être davantage sujette à controverses. Comment déterminer, parmi plusieurs hommes, lequel est le vrai père de l'enfant, ou comment apporter la preuve que tel homme est bien le père de l'enfant tandis qu'il le nie ?

La science permet d'apporter des réponses à ces questions de filiation et , quoique dits de paternité, ces tests ADN permettent aussi d'établir le lien mère-enfant.

En France, cette pratique est strictement encadrée sur le plan légal.

Aspects scientifiques

Si différentes méthodes permettaient d'apporter un début de réponse aux questions de filiation, c'est la génétique qui permettra d'apporter des réponses les plus complètes et les plus fiables.

Méthodes simples

Des tests assez simples ne requérant aucune analyse poussée peuvent donner de premières conclusions. Cependant, ils ne permettent jamais de confirmer un lien de parenté, ils ne peuvent qu'exclure certaines hypothèses.

Rappels des principes de l'hérédité

Voici quelques rappels d'hérédité et de génétique car même les méthodes simples décrites ci-dessous trouvent leur fondement dans les gènes.

Un caractère physique (couleur de cheveux, taille, etc. ) est la traduction de l'information génétique. Pour chacun de ces caractères, il existe deux informations différentes : l'une venue de la mère, l'autre venue du père. Celles-ci peuvent être contradictoires (yeux bleus vs. yeux marron) ou semblables (yeux marron et yeux marron).

Quelques règles permettent de déterminer selon les deux copies du gène quel sera l'aspect de l'individu :

  • Si le gène s'exprime à travers des copies (allèles) codominantes, l'aspect physique correspondra à la moyenne des deux informations. Ainsi un enfant qui aura reçu un gène'Grande taille'et un gène'Petite taille'sera de taille moyenne.
  • Si le gène s'exprime par contre à travers des allèles dominants et récessifs, l'aspect physique correspondra au gène dominant si l'individu en possède un. Le caractère physique récessif n'apparaîtra que si la personne a reçu l'allèle récessif correspondant de son père ET de sa mère.

Quand cet individu aura des enfants, il transmettra soit l'allèle de son père, soit celui de sa mère.

Méthode des gènes récessifs

En étudiant les caractères exprimés par des gènes récessifs, il est envisageable d'écarter certaines parentés. Ainsi, si un bébé a les yeux marron mais que sa mère a les yeux bleus, il est exclu que le père de cet enfant ait aussi les yeux bleus.

En effet, comme l'allèle'yeux bleus' (codant le gène'couleur des yeux') est récessif et que l'allèle'yeux marron'est dominant, un individu ne peut avoir les yeux bleus que si ses deux allèles du gène responsable de la couleur des yeux indiquent le bleu. Ainsi, si deux parents ont les yeux bleus, ils ne possèdent l'ensemble des deux que des allèles'yeux bleus'du gène'couleur des yeux'et ils ne pourront avoir que des enfants aux yeux bleus.

Cependant le caractère étant codé sur plusieurs gènes différents, il existe des cas rares où deux parents aux yeux bleus pourront donner naissance à un enfant aux yeux d'une autre couleur.

Méthode des groupes sanguins

Les groupes sanguins donnent aussi des indications sur la filiation. Une mère de groupe'A'ne pourra avoir d'enfant de groupe'AB'avec un père qui est aussi de groupe'A'ou qui est de groupe'O'.

Les caractères A et B des groupes sanguins d'un enfant doivent obligatoirement avoir été hérités soit du père, soit de la mère car les gènes exprimant ces 2 caractères sont codominants. Un couple de groupe sanguin A et B peut avoir un enfant de groupe O. Le gène exprimant le groupe'O', lui, est récessif : il ne s'exprimera qu'en l'absence des autres caractères.

Si le père et la mère sont de groupe A avec, dans les deux cas, un allèle'A'et un allèle'O', alors ils pourront avoir des enfants :

  • de groupe'A'avec deux allèles'A', ou
  • de groupe'A'avec un allèle'A'et un allèle'O', ou
  • de groupe'O'avec deux allèles'O'.

De la même manière, le rhésus négatif est récessif. Il ne s'exprimera qu'en l'absence du caractère positif. Si les parents sont de rhésus négatif, ils ne pourront pas avoir d'enfant au rhésus positif.

L'analyse ADN

Cette méthode, contrairement aux précédentes, requiert une analyse poussée de l'ADN de l'individu qui recherche ses parents mais aussi celui de son père et/ou de sa mère potentiels. Elle demande plusieurs jours mais permet d'arriver à des réponses particulièrement tranchées : soit elle écartera la filiation, soit elle conclura à une très forte probabilité de filiation (supérieure à 99%).

Principe

Chaque individu possède dans ses chromosomes des portions d'ADN qui codent des gènes et d'autres (l'ADN «poubelle») pour lesquelles aucune utilité n'a toujours été découverte. Cette dernière partie possède une caractéristique intéressante : parmi elle , certaines séquences de paires de nucléotides s'enchaînent, répétées comme une copie conforme. Ce sont les séquences répétées appelées minisatellites. La taille de ces minisatellites, correspondant au nombre de répétitions de séquences ADN, est particulièrement variable d'un individu à l'autre et peut aller de 5 à 50.

Cette taille est une caractéristique du chromosome. Elle s'hérite par conséquent de la même manière que les allèles de ce dernier : parmi chaque paire de chromosome d'un individu, il y en aura un qui correspondra aux caractéristiques du père et un autre à celles de la mère.

Le test de paternité consiste par conséquent à évaluer la taille de certains minisatellites bien spécifiques. En comparant pour chaque chromosome, ces caractéristiques entre les chromosomes de l'enfant et ceux de ces parents potentiels, il est envisageable d'arriver à des conclusions : voir l'exemple ci-dessous.

Technique

Afin d'arriver à déterminer les tailles des minisatellites d'un individu, il faut effectuer une analyse approfondie de son ADN. Ce dernier est extrait d'un échantillon prélevé sur l'individu (sang, salive, etc. ). L'ADN de chaque paire de chromosome est multiplié scindément par PCR (Réaction en chaîne par polymérase). Après cela, les brins sont découpés par une enzyme de restriction qui va isoler les minisatellites en préservant leur longueur. Ces morceaux d'ADN sont finalement analysés par électrophorèse : les molécules vont migrer et se regrouper en deux amas correspondant chacun à une taille différente de minisatellites (issus des 2 chromosomes de la paire). Comme les molécules de grande taille sont les moins mobiles, la distance parcourue sert à déterminer la taille des minisatellites.

Cette même technique est utilisée pour déterminer l'empreinte génétique d'un individu.

Exemple

Voici les cartes génétiques de 4 personnes (Aurore, Bastien, Christine et Denis) et de l'enfant de 2 d'entre eux, Émilie. Dans chaque tableau est indiqué pour chaque chromosome, la taille du minisatellite ACGCC. Ainsi Aurore possède sur son premier chromosome 14 la séquence ACGCCACGCCACGCC (nb répétition=3) et sur son autre chromosome 14, la séquence ACGCCACGCCACGCCACGCC (nb répétition=4).

ADN d'Aurore
Chromosome analysé Taille du minisatellite
chromosome 1 8 et 15
chromosome 8 13 et 14
chromosome 13 4 et 15
chromosome 14 3 et 4
ADN de Christine
Chromosome analysé Taille du minisatellite
chromosome 1 2 et 8
chromosome 8 17 et 20
chromosome 13 4 et 4
chromosome 14 2 et 14
ADN de Bastien
Chromosome analysé Taille du minisatellite
chromosome 1 8 et 18
chromosome 8 5 et 7
chromosome 13 3 et 9
chromosome 14 2 et 8
ADN de Denis
Chromosome analysé Taille du minisatellite
chromosome 1 5 et 13
chromosome 8 5 et 5
chromosome 13 4 et 18
chromosome 14 3 et 8
ADN d'Émilie
Chromosome analysé Taille du minisatellite
chromosome 1 8 et 13
chromosome 8 5 et 17
chromosome 13 4 et 4
chromosome 14 2 et 3

En comparant les différents tableaux, on arrive à la conclusion que Christine et Denis sont les parents d'Émilie. En effet, selon le chromosome 8, Aurore ne peut être la mère de l'enfant, car elle lui aurait transmis soit 13, soit 14 répétitions, or Émilie en possède 5 et 17. De la même manière, Bastien peut être écarté en se basant sur le chromosome 13 : il aurait obligatoirement transmis une de ces répétitions. Les patrimoines de Christine et Denis permettent d'expliquer totalement les caractéristiques des chromosomes d'Émilie. Afin d'augmenter toujours les probabilités de filiation, il faudrait comparer ces minisatellites sur davantage de chromosomes. Les laboratoires d'analyse parviennent à assurer des tests à l'issue desquels ils peuvent annoncer une probabilité de filiation excédant les 99%.

Exemples :

  • Après de nombreux rebondissements, ces examens ont permis de montrer qu'Aurore Drossard n'était pas la fille d'Yves Montand.
  • Albert II de Monaco a reconnu son fils Alexandre Coste suite à des analyses prouvant sa paternité.
  • Le cœur de Louis XVII a été authentifié grâce à des tests qui ont comparé son génome à ceux de parentes de Marie-Antoinette.

Généralités

En France, l'identification génétique (tests ADN) est strictement encadrée sur le plan légal : Elle ne peut être effectuée que occasionnellementbien précis, régis par les articles 16-10 à 16-13 du code civil, L 1131-1 à L 1133-10 et R 1131-1 à R 1132-20 du code de la santé publique, 226-25 à 226-30 du code pénal et L 111-6 du code de l'entrée et du séjour des étrangers et du droit d'asile.

Les tests ne peuvent être effectués que :

ou

ou

  • Afin d'identifier un militaire décédé dans le cadre d'opérations armées.

ou

  • Pour établir ou contester un lien de filiation.

Motivation

En dehors de l'aspect moral ou affectif de l'établissement d'une filiation, celle-ci entraîne des conséquences juridiques importantes sur le nom, la nationalité, l'autorité parentale, l'obligation alimentaire, la transmission du patrimoine, les empêchements à mariage etc.

L'avènement des tests ADN donne la possibilité d'établir une filiation juridique plus proche de la réalité génétique.

Cependant, la loi française interdit (sauf exceptions précises[1]) d'utiliser ces tests pour établir ou contester une filiation dans le cas d'une procréation médicalement assistée avec un tiers donneur. Dans ce cas, en effet, (comme dans la filiation adoptive) on sait que la filiation génétique ne correspond pas à la filiation juridique.

Conditions

(Il s'agit des conditions exclusives autorisant une recherche de la filiation maternelle ou paternelle par identification génétique).

Qu'il s'agisse du lien maternel ou paternel, l'identification génétique ne peut être recherchée qu'en exécution d'une mesure d'instruction ordonnée par le juge saisi d'une action tendant soit à l'établissement ou la contestation d'un lien de filiation, soit à l'obtention ou la suppression de subsides. Le consentement de l'intéressé doit être préalablement et expressément recueilli. [2]

En ce qui concerne la filiation maternelle seule, des lois récentes[3] ont introduit la possibilité d'effectuer, à titre expérimental, une identification génétique du demandeur d'un visa pour obtenir un élément de preuve de sa filiation maternelle. Là aussi, le consentement des personnes dont l'identification est ainsi recherchée doit être préalablement et expressément recueilli[4]. Un autre préalable est l'inexistence de l'acte de l'état civil étranger ou l'existence d'un doute sérieux sur l'authenticité de ce dernier qui n'a pu être levé par la possession d'état [5]. Là aussi, c'est un tribunal (tribunal de grande instance de Nantes) qui décide de l'opportunité ou non d'effectuer ces tests. Ce tribunal est saisi par les agents consulaires ou diplomatiques après information et consentement de l'intéressé.

Conséquences et réactions

Que ce soit pour la recherche de la filiation paternelle ou maternelle, les tests ADN ne peuvent être effectués que si un jugement les ordonne suite à une action relative à la filiation. Or, la filiation se prouve et se conteste par tous moyens sous réserve de la recevabilité de l'action [6]. Il s'ensuit qu'on ne peut engager une action avec pour seul moyen une demande de tests ADN (excepté concernant l'entrée et le séjour en France des étrangers comme précisé ci-dessus). Une telle action serait irrecevable. Pour qu'un juge ordonne l'exécution de tests, il faut des éléments préexistants et , si ce n'est probants, du moins présumant déjà la filiation. Le test ADN ne peut servir qu'à administrer une preuve fiable (probabilité d'exactitude supérieure à 99 %).

D'autre part, l'intéressé doit être d'accord pour faire ces tests. Deux cas peuvent alors se présenter :

  • L'intéressé donne son consentement, fait les tests et la filiation juridique est établie ou non selon le résultat.
  • L'intéressé refuse son consentement (ou accepte mais ne fait pas les tests) et il s'expose à ce que la filiation juridique soit établie (ou non) sur la base des seuls éléments en possession du juge, y compris son refus qui pourra alors être reconnu en sa défaveur.

A titre d'exemple, dans une procédure en vue de faire reconnaître la paternité (cas le plus courant), le non-consentement du père présumé de faire un test ADN peut être reconnu comme l'aveu implicite soit qu'il considère ce test inutile car il croit sa paternité réelle (et en accepte d'avance les conséquences), soit espère échapper aux obligations résultant de l'établissement de cette paternité si celle-ci n'est pas scientifiquement prouvée. Il s'expose par conséquent à ce que le juge tienne compte de son refus de faire les tests pour établir sa paternité légale même si celle-ci n'est pas réelle.


En résumé, si une procédure en justice est indispensable pour pouvoir effectuer les tests ADN, ceux-ci ne sont pas indispensables pour établir la filiation juridique (D'ailleurs, avant que ces tests n'existent, la filiation était établie sans eux. ).


En ce qui concerne les lois dites sur l'immigration, d'application récente, qui étendent l'autorisation de l'identification génétique à des fins administratives, elles ont soulevé diverses réactions de la part d'opposants [7] et ont subi plusieurs remaniements.

En l'état actuel de l'article L 111-6 du code de l'entrée et du séjour des étrangers et du droit d'asile, elles donnent la possibilité à une personne étrangère de prouver sa filiation maternelle par un test ADN afin d'obtenir l'autorisation de séjourner en France en cas d'inexistence d'acte d'état civil ou de la non reconnaissance de la validité d'un tel acte par les autorités diplomatiques ou consulaires. [8]

Références

  1. Voir articles 311-19 et 311-20 du code civil
  2. Article 16-11 du code civil
  3. [1]Loi nº 2006-1376 du 14 novembre 2006 art. 7 Journal Officiel du 15 novembre 2006; [2]Loi nº 2006-911 du 24 juillet 2006 Journal Officiel du 25 juillet 2006 en vigueur le 1er janvier 2007 au plus tard; [3]Loi nº 2007-1631 du 20 novembre 2007 Journal Officiel du 21 novembre 2007
  4. [4] article L111-6 du code de l'entrée et du séjour des étrangers et du droit d'asile
  5. [5] article L 111-6 du code de l'entrée et du séjour des étrangers et du droit d'asile
  6. Article 310-3 du code civil
  7. Bertrand Monthubert : «Cette mesure est complètement contraire à la loi de bioéthique de 1999»
  8. Tests ADN : Hortefeux fait un geste vers les sénateurs, Le Figaro. Consulté le 3 octobre 2007

Recherche sur Amazone (livres) :



Ce texte est issu de l'encyclopédie Wikipedia. Vous pouvez consulter sa version originale dans cette encyclopédie à l'adresse http://fr.wikipedia.org/wiki/Test_de_paternit%C3%A9.
Voir la liste des contributeurs.
La version présentée ici à été extraite depuis cette source le 17/09/2009.
Ce texte est disponible sous les termes de la licence de documentation libre GNU (GFDL).
La liste des définitions proposées en tête de page est une sélection parmi les résultats obtenus à l'aide de la commande "define:" de Google.
Cette page fait partie du projet Wikibis.
Accueil Recherche Aller au contenuDébut page
ContactContact ImprimerImprimer liens d'évitement et raccourcis clavierAccessibilité
Aller au menu